Can We Stop the Next Killer Flu?

"We're vastly outnumbered," says Ira Longini, a biostatistics professor at Emory University in Atlanta. "The microbial world is infinitely larger than we are. Much more varied, much more flexible. We virtually swim in it."

Although Anton van Leeuwenhoek developed the microscope in the 1600s and observed tiny "animalcules," no one could imagine that such humble organisms could bring a strong man to his knees, make skin burst into pustules and boils and lesions, cause wounds to putrefy and lungs to fill with blood. People assumed that illness came from the inhalation of noxious vapors, or as punishment for sins, or from the malign schemes of evil spirits.

The English doctor Edward Jenner noticed in 1796 that milkmaids sometimes caught a disease called cowpox. He showed that infected fluid from a milkmaid's hand, injected in another person, would provide partial immunity to the related disease of smallpox. But he had no idea that pox came from a tiny entity that would someday be called a "virus."

Medical science, so advanced today, was a primitive field compared with such noble endeavors as engineering and physics. But gradually, a germ theory of disease began to form. Englishman John Snow in the 1850s made careful observations of a cholera outbreak in London, plotting the location of the sick and dying, and eventually tracked the epidemic to a single contaminated well. Surgeons discovered that if they washed their hands their patients had a better chance of survival. Louis Pasteur argued that microorganisms caused not only fermentation but also any number of human diseases. In 1876, the German physician Robert Koch showed that anthrax came from a bacterium. One by one, science linked diseases to microorganisms. But viruses were hard to nail down. They were too small to see.

The 1918 pandemic was all the more terrifying for being so mysterious. Flu mortality by age group normally shows a bathtub-shaped curve, killing primarily young children and the very old, but the 1918 germ had a W-shaped curve, with a huge spike among healthy people in their twenties. Many were soldiers in military camps and troop transport ships. This seemed almost a medieval disease, wildly contagious, capable of killing its victims within two days. The lungs filled with a thick bloody fluid. A doctor at Camp Devens, near Boston, wrote of the dying soldiers, "Two hours after admission they have the Mahogany spots over the cheek bones, and a few hours later you can begin to see the Cyanosis extending from their ears and spreading all over the face, until it is hard to distinguish the coloured men from the white."

There were rumors that this pestilence was nothing less than the Black Death, the bubonic plague of the 14th century. When the disease spread to Philadelphia, there were not enough caskets, and bodies lay rotting in the slums, in hallways and on porches. The corpses were stacked by the hundreds at the city morgue. The pathogen swept the country, targeting crowded military installations, where the sick and dying overflowed hospitals and jammed every corridor, surrounded by bloody sheets, vomit, urine, feces and buzzing flies. At Camp Grant, in Illinois, more than 500 soldiers died, and the commander finally put a bullet through his brain. The explosive nature of the disease mimicked the behavior of the virus itself, replicating by the thousands in an individual cell, and bursting forth to run riot all over the lungs. Not until 1930 did scientists manage to isolate an influenza virus.

The horrors of World War II, and the search for cures for infections, helped usher in a glorious era in microbiology. A scientist named Alexander Fleming had made the fortuitous discovery that bacteria in his lab died in the presence of bread mold, leading to the invention of penicillin and other antibiotics. And, although agents that killed viruses weren't just sitting around in nature waiting to be discovered, scientists were able to develop vaccines for polio, measles and other childhood diseases.

Still, viruses were enigmatic. It took many decades, well into the 1970s, for science to grasp what these things were and to understand their diabolical genius.

A virus is arguably not truly alive. A virus cannot replicate or evolve unless it is inside a host. It's a parasite, hijacking the host's cellular machinery. For example, the flu virus when inhaled infects the upper respiratory tract (though the 1918 virus went deep into the lungs). The virus penetrates a cell, inserts its own genetic game plan and forces the cell to make copies of more virus. Cells can die in the process, and others can be killed by the host's immune system as it desperately tries to wipe out the invaders. Bacteria set up shop among the slaughtered cells. Death can often follow from this secondary bacterial pneumonia.

Modern medicine struggles to attack viruses, because they're so deeply insinuated into cells. It took the advent of recombinant DNA, the techniques of splicing and dicing genes, for medical science to produce the first antivirals, which don't kill viruses outright but suppress their ability to replicate.

When isolated, outside a cell, a virus is a biological zero. It has no metabolism, processes no energy and might hang together for just a day before falling apart.

Viruses are made of either DNA or RNA, the two genetic molecules of Earth life. There's not much else to them. You might describe them as data in search of an argument. The virologist Peter Jahrling has a sign in his office saying, "A virus is just a piece of bad news wrapped in a protein." Taubenberger likes an automotive analogy: "You can think of them as very streamlined life forms, like race cars. They don't have any extraneous stuff."

The success of viruses implies that the fundament of life is not liquid water, or carbon molecules, or some mysterious essence, but rather information.

Deeper Into the Code

TAUBENBERGER THINKS ABOUT LETTERS. TGG. CAG. TAC. AAA. These are the DNA bases, tripled up, forming what's called a codon, the instructions for an amino acid. Put enough amino acids together, and you've got a working protein. A single copying error during viral replication, an A becoming a G, can change an amino acid, alter the structure of the protein and perhaps change the way the virus behaves.

So Taubenberger has letters on his mind. He calls them up on his computer screen and prints them out, eight separate pages, a page for each influenza gene segment.

What's the message -- no, the music -- in those letters?

Music and genetics are both important to him. Like many scientists and mathematicians, he composes music in his spare time. Chamber music. Symphonies. He wrote a comic opera in college, at George Mason University. He used to play the oboe. Music and the genetic code, he says, "both rely on a stable kind of alphabet in a sense. There are only so many notes available, and there are 12 different tones. All music" -- he later stipulates that he's talking about Western music -- "whether it's Bach or rock-and-roll, it's all using selected combinations of those 12 tones."

Right there is the genius of life on Earth.

"There's an infinite way to arrange the genetic code. Here it is, it's only four different letters, and it makes things as different as flu viruses and oak trees and fruit flies and fruit bats."

Influenza is tiny. It's made out of RNA, the smaller, one-stranded cousin of DNA. A human being has a genome with about 3 billion letters, but a flu virus has just 13,500. Here, converted by scientific custom into the alphabet of DNA, are the first of the 1,681 letters that code for the protein hemagglutinin in the 1918 flu virus:

atggaggcaagactactggtcttgttatgt . . .

Wait, it gets better. Check this out, from the middle of the gene:

. . . ggggtctatttggagccattgccggttttattgaggggggatgg . . .

Perhaps it looks like gibberish at first glance. Also second glance. Even Taubenberger says, in a burst of honesty, "It's very hard to know where the meaning is."

But he sees patterns. All genes start with the codon ATG, which corresponds to the amino acid methionine; all genes stop with one of three codons that effectively shout, "Halt!" There's some slop in the system: There are 64 possible codons of the four letters, but only 20 amino acids are used by Earth life. This means several different three-letter combinations will sometimes lead to the same amino acid. Biologists, perhaps ungenerously, call the code "degenerate" because of this imprecision.

By studying these letters, Taubenberger has already decided that, among flu viruses, 1918 is strange. Down at the level of the GGC and ATA and CCT and TTT and so on, it just isn't like any of the bird flus currently in circulation. Could the differences be caused by bird flus evolving dramatically between 1918 and today? Taubenberger went to the Smithsonian and said, in essence, I need an old bird. A curator produced a carefully preserved brant goose, collected in Alaska in 1917. Taubenberger found a remnant of bird flu in the goose, studied it in his lab, and saw that it wasn't that different from contemporary bird flus. Samples of other birds circa World War I led to a firm conclusion: The Spanish influenza wasn't like the wild bird flus then circulating.

"It came from a donor host that we don't know about," he speculates.

A strange bird, never studied by virologists, perhaps. An odd duck. Or perhaps some of the 1918 virus's evolutionary history took place not only inside a bird but also within an entirely different sort of animal -- a mystery mammal.

The hemagglutinin protein is of particular interest, because it's on the surface of the virus, and it determines whether the virus will bind to a cell or keep swimming past. Because it sticks up on the outside of the virus, it's the target of the immune system's antibodies. A simple mutation can cause the hemagglutinin to change structure and suddenly be less recognizable to the antibodies that patrol for flu viruses.

Flu evolves at a breakneck pace, because it makes so many copying errors as it replicates. A CGT could become, for example, a CCT, changing one amino acid in the resulting protein. Chances are, that won't do the virus any good. Most mutations are deleterious. But every so often a copying mistake will lead to a virus that replicates faster, or can penetrate more deeply into the lungs, or can colonize the cells of a different animal.

Which mutations should we fear most? Taubenberger doesn't know.

"We don't know anything!" he says.

A Coming Plague?

HE'S EXAGGERATING. HE KNOWS A LOT. But probably the least appreciated and most important phrase in science is "We don't know." Uncertainty is built into the fabric of science. It keeps scientists humble. Sometimes it can make them sound a little dodgy. You can talk to scientists until the cows come home and never hear a completely definitive statement. Everything is hedged, preliminary, subject to revision. Scientists are uncomfortable with absolutes in a universe built on perplexing relativistic principles and spooky quantum mechanics. Even the constants of nature, like gravity, are now viewed as a little squishy around the edges.

If you ask Taubenberger a big, thorny question, he'll likely say, "The answer is 42." It's a reference to the signature irony in The Hitchhiker's Guide to the Galaxy, and the narrator's quest to find the meaning of life. Taubenberger responded to one overly broad biology question by saying, "I'll give you a highly technical answer: We don't know."

Everyone has the same question about avian flu: How worried should we be? The short answer (other than "nobody knows") is that, although it's a nasty virus, it would be premature to cancel plans for the rest of one's life. It's not time to go into survivalist mode, living off canned food and wearing a hepa-filter mask 24 hours a day.

When digesting stories about avian flu, one should remember that the media love a good End Is Near tale. Doom is good for ratings. The most alarmist voices invariably will be the most quoted. One network stated in prime time that a billion people could die of this flu -- yes, billion with a "b." Some of the experts sounding the most dire alarms may be on a quest for funding. One expert told a group of congressional staffers this fall that when the pandemic strikes, "time will be described, for those left living, as before and after the pandemic." Except that wasn't true after the pandemics of 1957 and 1968, and it wasn't true even after 1918. The Spanish influenza was so overshadowed by World War I that historian Alfred Crosby wrote a book about it called America's Forgotten Pandemic.

No doubt, the H5N1 strain (the H stands for hemagglutinin, the N for neuraminidase) is the most worrisome type of wild bird flu, because it has already shown that it can infect people and kill them. And each person it infects is a kind of petri dish for further mutation. If a person who already has a human flu is simultaneously infected with a bird flu, the two strains can "reassort" into a new flu that has the worst qualities of the original two. Or the bird and human viruses could reassort inside a pig. Researchers have heard tales of farmers feeding bird-flu-infected chickens to pigs.

All these animals in all these places represent yet more petri dishes. For this reason, "avian flu" is already an oversimplified term. The avian flu of the newspaper headlines, H5N1, has led to countless mutant strains. Viruses don't break down easily into distinct species. Rather, they're like a cloud, a mist of slightly different genetic entities, that blows across the landscape. The H5N1 strain catalogued as A/Vietnam/HN30408/05 is not exactly the same as the one called A/Vietnam/JPHN30321/05 or A/Duck/GuangXi/13/2004.

We also don't know what would happen to the virulence -- the deadliness -- of the avian flu if it did become a human contagion. Contagiousness and virulence are often at cross-purposes. Ebola, a frightening filament-like virus that causes uncontrolled bleeding throughout the victim's body, burns so hot as a disease that it usually kills people before they have much of a chance to spread it. Emerging viruses that are initially highly lethal, such as avian flu in the human cases seen so far, often evolve toward lower virulence for their own survival. Even the merciless 1918 virus evolved into a milder strain. Jahrling, the virologist, says: "The equilibrium seems to be toward lower virulence, toward an accommodation with the host. It's not smart to kill your host."

What does Jahrling think will happen in the case of avian flu?

"We can't prognosticate evolution," he says.

We can keep our eyes open. If, based on genetic flu research like Taubenberger's, scientists knew exactly which mutations were critical to the emergence of a pandemic strain of flu, and if health officials carefully monitored the strains evolving in the influenza hot spots of Southeast Asia, China and Indonesia, it might be possible to snuff out a dangerous strain before it could spread.

The U.S. government has to prepare for the worst, even at the risk of later being accused of overreacting. The Department of Health and Human Services, on November 1, issued its long-awaited pandemic influenza plan. President Bush, trying to recover from the Katrina fiasco, went to the National Institutes of Health to unveil the plan and, in effect, declare war on flu. He asked Congress to spend $2.8 billion to make vaccine production faster. He asked for $1.2 billion to stockpile an avian flu vaccine that is still in trials. He asked for another billion to stockpile antiviral drugs such as Tamiflu and Relenza. Bush said Americans can't wait for the microbial terrorists to come here, but rather must attack them where they originate. "Our country has been given fair warning of this danger to our homeland, and time to prepare," Bush said.

He'd run up a $7 billion tab in just a few paragraphs, but no one in the crowd, all leaders of the Disease Industry, was going to protest. (The germs themselves have no lobbyists.) The plan has run into some budgetary and political troubles, but the broader problem may be scientific and technological. Vaccines aren't magic bullets. Influenza, like HIV, is a moving target. This year's avian flu vaccine may not do any good in a couple of years. There are limits to our ability to force the natural world to conform to our schedules and projected budgets for the next fiscal year. Pandemics, like earthquakes and hurricanes, don't obey our dictates.

The H5N1 virus surfaced in humans in 1997, when it killed a 3-year-old child in Hong Kong. The flu experts sounded the alarm. Pandemic possible. No one has immunity. This could be the Big One. Then H5N1 receded from view. Robert Webster, perhaps the leading researcher on avian flu, told an audience soon thereafter, "If this virus had learned to spread from human to human, at least half of you would not be in this room today."

Eight years later, all the alarms are going off again. The virus reemerged in 2003 in southern China. It has devastated poultry farmers. Carried by migrating birds, the virus has spread westward across the Eurasian landmass, to Europe. In the United States, poultry farms have become high-security zones. And now winter is here. Flu season.

If one wants to be optimistic, one can consider that avian flu has had abundant opportunity in recent years to mutate or reassort into a pandemic human virus. Does it need more time? Or is there some biological barrier that it can't surmount?

"If it's going to do this, why hasn't it happened already?" Taubenberger asks.

There are at least 16 subtypes of bird flu, based on differences in the hemagglutinin protein coat. The subtypes are called H1, H2, H3 and so on, but the numbers are just convenient labels; an H2 flu doesn't have twice as much hemagglutinin as H1. We don't know how many of the 16 subtypes of bird flu are capable of jumping species and causing human flu pandemics, but it appears that the five most recent pandemics -- 1850, 1890, 1918, 1957 and 1968 -- were caused by just three subtypes (H1, H2, and H3). Could it be that those are the only three subtypes capable of causing flu pandemics?

We don't know.

If there's one certainty, it's that germs are a growth industry. When Richard Krause took over the National Institute of Allergy and Infectious Diseases in 1975, it ranked only eighth in funding among the various institutes of NIH, he recalls.

"We didn't get much funding because people no longer thought infectious diseases were important. Follow the money. If you want to know what the public thinks is important, follow the money," says Krause, who stepped down as director in 1984.

Many of the people who study pathogens have a new headquarters, or a new laboratory, or a new vaccine plant, or some other shiny piece of infrastructure. The infectious organisms themselves are nothing to look at -- microbiology as a science involves lots of tiny vials holding clear, colorless liquids -- but the buildings (the structures!) are increasingly impressive.

At the Centers for Disease Control and Prevention in Atlanta, the new security entrance leads to the new garage, the new visitor center and two new high-rise buildings jammed with offices and laboratories. Go to Fort Detrick in Frederick, where the Army has, for years, studied scary microbes in a drab, aging facility, and you'll learn of a new building going up under the auspices of NIAID. Just south of town, NIAID also has a new $65 million vaccine pilot plant tucked into an industrial park.

Perhaps what's truly different today is not that we're more vulnerable to disease, but that we're less tolerant of it. The idea of a loved one being swept away by a pestilence is unthinkable. We're eager to pay for protection against microbes. And we know that, even if H5N1 doesn't turn pandemic, some other flu strain could, and there are other germs out there, lurking, biding their time, evolving. The list is long and scary: HIV. Monkey pox. Ebola. Marburg. Dengue hemorrhagic fever. Lyme. Chronic wasting disease. Drug-resistant staph and strep. And there are diseases that don't even have names -- bacteria and viruses that doctors have never seen before.

In addition to remembering to wash their hands, Americans should realize that they're in a relatively privileged position, with access to health care and medication that's rare in much of the world. Countless people on the planet suffer from rather mundane but totally treatable and curable diseases. The leading killer worldwide of children is diarrhea caused by parasites. Those children don't need a new vaccine; they need clean water.

Most people in America aren't worried about TB, or malaria, or measles, or diarrheal diseases, because they don't know anyone who's dying of them.

Steven Holland, a physician who treats infectious diseases at NIH, says, "It's like most things: All politics is local, and all infectious disease is local."

Fighting the Mutant Swarm

ON THE NIH CAMPUS, MICROBIOLOGIST Kanta Subbarao has three candidates for an avian flu vaccine already in the pipeline. But she wants vaccines that might be useful against any of the 16 subtypes of flu. For example, she worries that an H9 flu virus could become pandemic. It's not very virulent in humans at the moment, but it's all over the place, and it could reassort into something more lethal. So add that to the list, next to the H5 subtypes: the threat of H9.

Also H7.

"There was a large outbreak in 2003 in poultry in the Netherlands," she reports. Several people who handled infected birds caught the H7 flu themselves, and one died. Then H7 vanished.

That's the nature of viruses that lurk in animal reservoirs. One reason we don't worry about a natural outbreak of smallpox is that it's an entirely human virus. It hasn't merely retreated, it has gone extinct in the wild. This is not the case with influenza, or with, to take the example of something that Subbarao has in her lab, the SARS virus. It put a scare in the world three years ago and killed about 800 people, but since has vanished. SARS turned out to be a public health triumph -- officials were able to quarantine infected people before the pathogen could become pandemic. No one ever figured out where SARS came from. Civet cats, maybe? Bats? Is it still out there, somewhere?

There is so much we don't know.

"The more you know," says Dave Evers, one of Taubenberger's postdoctoral fellows, "the more you know that you don't know."

Taubenberger wants more data. More code. "Maybe we're not doing enough," he says. "We need lots more sequences to help understand the significance of what's happening with H5." He wants to look at human flu viruses, pig flu viruses, horse flu viruses, everything out there.

As he talks about this, he appears a bit fatigued. It's so much work, breaking these codes. Just look at his desk already: too many papers, too many articles to read, too many printouts, all of it pushing up against that prop from his 10th-grade science project, that double helix, which looks simpler and more elegant by the minute.

"My life at work has basically spun a little bit out of control," the scientist says. "I live in barely contained chaos all the time."

But that's just life on Earth.

Joel Achenbach is a Magazine staff writer. He will be fielding questions and comments about this article Monday at 1 p.m. at washingtonpost.com/liveonline.